rs12281049 chr11:66372383 G>A
- Sequence
ctcataatctacgaataggtgtgg[G/A]ttctctgcaatccccgggcgtatc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | n/a | 2.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Esophagus_Mucosa, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood