rs12281346 chr11:117426176 G>C
- Sequence
tcgggatccgtcatgtattttcat[G/C]acagcgttccccttcggagccctt
- ASB in cell types
- tibial nerve T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 2.63 | -2.42 | 1.00 | |||
| T47D (invasive ductal carcinoma) | -0.14 | 1.16 | 2.00 |
Items per page:
1 – 2 of 2