rs12283300 chr11:71787555 G>T
- Sequence
cccgtcatggcgcccgaggagaac[G/T]cggggagcgaactcttgctgcaga
- ASB in cell types
- HCT-116 (colon carcinoma) GM01310 ( Transformed lymphovlasoid cell line ) primary B-CLL cells CD14+ monocytes
- ASB for transcription factors
- MED26_HUMAN AHR_HUMAN SP1_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MED26_HUMAN | 2.45 | -1.90 | 1.00 | n/a | n/a | |||
| AHR_HUMAN | 3.11 | -4.65 | 1.33 | n/a | No Hit | |||
| SP1_HUMAN | 1.98 | -1.37 | 1.00 | -2.11 | Concordant | |||
| TYY1_HUMAN | 1.89 | n/a | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | 2.08 | -0.22 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood