rs12286590 chr11:128174823 A>G
- Sequence
tgtcccccagctgtttttgcaaat[A/G]tctgttttgtcacgggggtggcta
- ASB in cell types
- HS-ES-2M (Epithelioid sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-ES-2M (Epithelioid sarcoma) | 2.04 | 1.16 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins