rs12402451 chr1:27161808 T>C
- Sequence
ttattgtaaggatgaaaaggccac[T/C]gtatgtcaagcatagttcctggta
- ASB in cell types
- HT29 (colon adenocarcinoma)
- ASB for transcription factors
- NR1H3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR1H3_HUMAN | 2.14 | -1.26 | 2.00 | -1.02 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, biploar disorder (bipolar schizoaffective disorder), bipolar disorder in alcoholics, birth weight, height, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Minor_Salivary_Gland, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood