rs12603463 chr17:13421193 C>T
- Sequence
gcctattgctctcaaccttcaaac[C/T]agtaccacatgcaactgtaatgaa
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZGPAT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZGPAT_HUMAN | -2.69 | 2.77 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, body mass index (bmi)