rs12610820 chr19:632494 G>C
- Sequence
ccaggacagctgagtcagttcagg[G/C]ttcacatcctggctctgcacatgt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SP130_HUMAN ARI4B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP130_HUMAN | 3.67 | n/a | 1.00 | n/a | n/a | |||
| ARI4B_HUMAN | 2.27 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis