rs12610871 chr19:38271097 T>C
- Sequence
gaactttggagtttatttaccttt[T/C]tttgttgttttattttccttggca
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FEZF1_HUMAN SCRT2_HUMAN ZN770_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | n/a | 3.19 | 5.00 | n/a | No Hit | |||
| SCRT2_HUMAN | n/a | 3.14 | 5.00 | n/a | No Hit | |||
| ZN770_HUMAN | n/a | 3.27 | 5.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid