rs12611482 chr2:154402432 G>T
- Sequence
tgatttcaaacatcaaaacacaag[G/T]gggaaaaatgccctcaagtttgtg
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -1.73 | 2.26 | 1.00 | |||
| foreskin keratinocyte | 2.03 | -4.73 | 2.83 |
Items per page:
1 – 2 of 2