rs12611670 chr2:176583069 T>C
- Sequence
gcagtagcatcaccagagaagtca[T/C]cctccctcctggctgctcctacag
- ASB in cell types
- HAEC (human aortic endothelial cells) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | -2.21 | 3.00 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -0.28 | 1.00 | 1.67 |
Items per page:
1 – 2 of 2