rs12612008 chr2:183124909 C>T
- Sequence
cgcggtacacgtgggtgggcggtg[C/T]cctgaagtgtgtgggtgcagtcca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neural cell MOLT-4 (Adult T acute lymphoblastic leukemia) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- SMC3_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.62 | -1.51 | 1.00 | n/a | n/a | |||
| TCF21_HUMAN | 1.68 | -1.60 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood