rs12613956 chr2:44244270 T>G
- Sequence
tccatctgtaaacctgctgagagc[T/G]ctggtgacaagaaaggcagtggct
- ASB in cell types
- pancreas CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -1.22 | 1.22 | 1.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.10 | 0.91 | 1.00 |
Items per page:
1 – 2 of 2