rs12614680 chr2:34171059 A>G
- Sequence
aaaatcatggcagaaagggaagtg[A/G]aaacatctttcttcacaaggtggc
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 1.99 | -0.23 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, cystatin c in serum, fasting insulin, homa-b, homa-ir