rs12618057 chr2:200306632 T>C
- Sequence
gacaccgaggggaaggcgggcggg[T/C]cggcgggcgggggcagcctgcgag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HeLa (cervical adenocarcinoma) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
- ASB for transcription factors
- PKNX1_HUMAN INT11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -1.10 | 1.44 | 1.33 | n/a | No Hit | |||
| INT11_HUMAN | -0.53 | 2.11 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood