rs12620040 chr2:37833126 C>A
- Sequence
ttaggatgccactgtgatacaaga[C/A]aatcttagtactgaattcctagag
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.98 | 0.44 | 1.22 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Spleen, Whole_Blood