rs12620195 chr2:54669988 C>A
- Sequence
gacagagatagtaaatattttagg[C/A]tttgtaggccgtaactgtctctgt
- ASB in cell types
- monocyte-derived macrophages from peripheral blood LS180 (colon cancer) A549 (lung carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CEBPB_HUMAN STAT3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.14 | -0.05 | 1.44 | n/a | No Hit | |||
| STAT3_HUMAN | 2.79 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Thyroid, Whole_Blood