rs12620473 chr2:30208669 G>A
- Sequence
gcctaagaaagcagaagggagcca[G/A]tgaggactgctgcaaaggctcctt
- ASB in cell types
- A549 (lung carcinoma) HuCCT1 (intrahepatic cholangiocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.81 | 1.04 | 1.03 | |||
| HuCCT1 (intrahepatic cholangiocarcinoma) | -0.86 | 1.93 | 2.00 |
Items per page:
1 – 2 of 2