rs12620517 chr2:68943725 C>T
- Sequence
tagctagactaatattctgccacc[C/T]ggctcctttgtgtatccgggcctt
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma) ID00015 (lymphoblastoid cell) DOHH2 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 2.28 | -1.76 | 1.00 | |||
| ID00015 (lymphoblastoid cell) | 2.17 | n/a | 1.00 | |||
| DOHH2 (diffuse large B-cell lymphoma) | 2.06 | n/a | 1.00 |
Items per page:
1 – 3 of 3