rs12622238 chr2:9212519 G>A
- Sequence
gatctactcctgaggtggtggcca[G/A]ctcggcgtctgcggtaggattttc
- ASB in cell types
- MCF7 WS8 cells MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 WS8 cells | 0.23 | 1.46 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.28 | 0.89 | 1.23 |
Items per page:
1 – 2 of 2