rs12623348 chr2:15748901 A>G
- Sequence
gattcctaaaccgcaaacgggtta[A/G]taacagcgccccctcctggctgct
- ASB in cell types
- PC9 (lung adenocarcinoma) NB69 (neuroblastoma) GM18486 (Lymphoblastoid Cell Lines) thyroid gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.61 | 1.08 | 1.29 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, hdl cholesterol, ldl cholesterol change with statins, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), total cholesterol change with statins, triglycerides