rs12627779 chr22:49176142 G>A
- Sequence
gaaggacggctgtccttgttacac[G/A]atggcaaagaacttggctgaactg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- NFIB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIB_HUMAN | -1.92 | 1.97 | 1.17 | -1.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, childhood acute lymphoblastic leukemia, ldl cholesterol change with statins, total cholesterol change with statins