rs12628201 chr22:37421008 G>C
- Sequence
aaagcattaaaattgcaagttcct[G/C]caattttcccctcgtccactctcc
- ASB in cell types
- macrophages NOMO-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 2.44 | n/a | 3.00 | |||
| NOMO-1 (acute monocytic leukemia) | 0.20 | 1.31 | 1.00 |
Items per page:
1 – 2 of 2