rs12628771 chr22:49176071 C>T
- Sequence
cagaaatggggatcataaagacca[C/T]tctggcaaggtgccagtgggagtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- NFIB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIB_HUMAN | -1.78 | 2.01 | 1.17 | 0.20 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, childhood acute lymphoblastic leukemia, ldl cholesterol change with statins, major depressive disorder, neuroticism, total cholesterol change with statins