rs12629106 chr3:177377284 C>T
- Sequence
gcttttctgcttattttcaagtga[C/T]gcccgtgttggcaccttagctcca
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.05 | -0.82 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-dsdna autoantibody status in systemic lupus erythematosus (sle) patients, birth weight, hdl cholesterol change with statins, triglycerides
PheWAS abnormal reflex, acquired deformities of limbs, acute periodontitis, adverse effects of antilipemic and antiarteriosclerotic drugs, agorophobia, social phobia, and panic disorder, anal and rectal polyp, arterial embolism and thrombosis of lower extremity artery, bacterial pneumonia, barretts esophagus, benign neoplasm of other parts of digestive system, bladder cancer, bladder cancer and neoplasms, bundle branch block, cholangitis, chronic osteomyelitis, chronic pain syndrome, chronic pancreatitis, cns infection and poliomyelitis, corneal opacity, diseases of the tongue, disorders of refraction and accommodation, eating disorder, fracture of pelvis, fuchs dystrophy, genital prolapse, hypertrophy of female genital organs, infections of kidney, irregular menstrual cycle, ischemic stroke, lack of coordination, late effects of cerebrovascular disease, liver replaced by transplant, loose body in joint, mental disorders due to brain damage, muscle weakness, occlusion and stenosis of precerebral arteries, occlusion of cerebral arteries, other disorders of eyelids, other signs and symptoms in breast, other specified nonpsychotic and/or transient mental disorders, paralysis/spasm of vocal cords or larynx, periapical abscess, periostitis, pneumococcal pneumonia, polycythemia vera, portal hypertension, pulmonary heart disease, pyogenic arthritis, seborheic dermatitis, secondary hyperparathyroidism (of renal origin), secondary malignant neoplasm of liver, sensorineural hearing loss, severe protein-calorie malnutrition, sinoatrial node dysfunction, symptoms involving nervous and musculoskeletal systems, transient cerebral ischemia, traumatic arthropathy, tuberculosis, type 2 diabetic peripheral circulatory disorders, ulcer of esophagus, upper gastrointestinal congenital anomalies