rs12630112 chr3:77715773 C>G
- Sequence
ttcatggcatgagttattaattgc[C/G]aaacaccaaaatattgagaaattt
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 0.10 | 3.46 | 1.50 | 4.66 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, hdl cholesterol change with statins, microalbuminuria, total cholesterol change with statins