rs12630194 chr3:27360194 A>G
- Sequence
atgggaactatatgtggagttagc[A/G]gaaaagagacagctatgacaagaa
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | 2.20 | 0.03 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, childhood acute lymphoblastic leukemia, diastolic blood pressure (dbp), height, systolic blood pressure (sbp), triglycerides change with statins
GTEx eQTL Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Testis