rs12630639 chr3:176872905 C>T
- Sequence
actgagctgaactcagctgatgcc[C/T]atcctcaccggcagagggagcatt
- ASB in cell types
- HEK293 (embryonic kidney) OCI-LY7 (diffuse large B-cell lymphoma) GM12878 (female B-cells lymphoblastoid cell line) GM12873 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.03 | 0.79 | 1.43 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.28 | -0.32 | 1.25 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.56 | 1.07 | |||
| GM12873 (female B-cells) | 1.88 | -1.59 | 1.00 | |||
| medulloblastoma | 2.36 | -3.83 | 1.33 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, partial epilepsy, urinary albumin-to-creatinine ratio, waist hip ratio