rs12633819 chr3:66397883 A>G
- Sequence
cggcccgactgcctgcttctgtca[A/G]tgtgactttatgggcacatagcca
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.22 | 0.99 | 1.26 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, alzheimers disease, amyotrophic lateral sclerosis (als), fasting blood glucose, salmonella-induced pyroptosis, simpson-angus scale, systolic blood pressure (sbp)
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg