rs12635565 chr3:189586719 G>A
- Sequence
ctctactatttgagctgacctatc[G/A]tattgttagatagttctgtttaga
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.48 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins, microalbuminuria, rheumatoid arthritis, urinary albumin-to-creatinine ratio