rs12635698 chr3:16366982 T>C
- Sequence
caaacttgaggactgtacaagtct[T/C]tctatgtcccagggtgggaggcat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.00 | 2.95 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, extreme obesity (body mass index (bmi)), glaucoma (normal pressure glaucoma)
PheWAS abnormal coagulation profile, abnormal electrocardiogram, acquired deformities of finger, acquired foot deformities, acquired toe deformities, acute bronchitis and bronchiolitis, anal and rectal conditions, anal and rectal polyp, anemia of chronic disease, ankylosis of joint, anxiety disorder, atherosclerosis, atherosclerosis of the extremities, atrial fibrillation, atrial fibrillation & flutter, benign neoplasm of other parts of digestive system, benign neoplasm of uterus, biliary cirrhosis, blood vessel replaced, bronchitis, cardiac conduction disorders, cardiac congenital anomalies, cardiac dysrhythmias, cardiac pacemaker/device in situ, cardiac shunt/ heart septal defect, cerebral atherosclerosis, cervical radiculitis, chondrocalcinosis, choroidal degenerations, congenital anomalies of limbs, congenital deformities of feet, crystal arthropathies, curvature of spine, delirium due to conditions classified elsewhere, diseases of blood and blood-forming organs, diseases of lips, diseases of the oral soft tissues, disorders of conjunctiva, disorders of menstruation, disorders of synovium, tendon, and bursa, dysmetabolic syndrome x, encounter for long-term use of anticoagulants/antithrombotics, exophthalmos, femoral hernia, flat foot, gout and other crystal arthropathies, gross hematuria, hammer toe, hydronephrosis, hypopotassemia, impetigo, inflammation of the eye, inflammatory and toxic neuropathy, inflammatory bowel disease, insulin pump user, intervertebral disc disorders, irregular menstrual cycle/bleeding, kidney replaced by transpant, kyphosis (acquired), left bundle branch block, lipoprotein disorders, mastoiditis, menopausal & postmenopausal disorders, mental retardation, morbid obesity, muscle weakness, nephritis & nephropathy, nonallopathic lesions nec, obesity, osteoarthrosis, osteoarthrosis of multiple sites, other conditions of brain, other disorders of back, pain in joint, pain in limb, palpitations, peripheral angiopathy in diseases classified elsewhere, peripheral enthesopathies, peritoneal adhesions (postoperative) (postinfection), phobia, poisoning by other anti-infectives, postmenopausal bleeding, postmenopausal hormone replacement, pruritus and related conditions, psoriasis, psoriasis & related disorders, psoriasis vulgaris, retinal hemorrhage/ischemia, secondary malignant neoplasm of liver, secondary thrombocytopenia, streptococcus infection, sulfonamides, symptomatic menopause, symptoms involving nervous and musculoskeletal systems, type 2 diabetic peripheral circulatory disorders, unstable angina (intermediate coronary syndrome), varicose veins of lower extremity, symptomtic