rs12639338 chr3:59451193 A>G
- Sequence
tgcaggcaggacattcagccctgt[A/G]tcttgccactaccatgaaatctga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN BRD4_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.27 | 1.62 | 1.00 | n/a | No Hit | |||
| BRD4_HUMAN | 1.97 | -0.05 | 1.00 | n/a | n/a | |||
| IKZF2_HUMAN | 1.18 | -0.58 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, obesity with early age of onset (age >2), salmonella-induced pyroptosis