rs12639792 chr4:25994234 G>A
- Sequence
ctccaactccacaactgataggtg[G/A]aagtttaaaccccagaacctcaaa
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.08 | -1.64 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, irritible bowel syndrome, rheumatoid arthritis, total cholesterol, transmission distortion, triglycerides, triglycerides change with statins, waist hip ratio