rs12639886 chr4:159107717 G>A
- Sequence
gctaagtacttggtagaattcatc[G/A]tgagtcataatgagagggctgaaa
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | n/a | 2.79 | 1.33 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.40 | 0.96 | 1.11 |
Items per page:
1 – 2 of 2