rs12640186 chr4:3372812 C>T
- Sequence
ggggttgtcttcaggctgccagag[C/T]gtgacagaaagaactttctagaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- IKZF2_HUMAN NFAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.61 | -4.69 | 1.50 | n/a | n/a | |||
| NFAC3_HUMAN | 2.67 | -2.54 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, total cholesterol, triglycerides, triglycerides change with statins, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood