rs12641877 chr4:10526602 G>A
- Sequence
ggaggagattggggtgcacagctc[G/A]tcatggcgcttgtattctcacgcc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.99 | -1.64 | 1.00 | |||
| Peyer's patch | -1.71 | 2.11 | 1.00 |
Items per page:
1 – 2 of 2