rs12644284 chr4:153232848 A>G
- Sequence
cagggtttctggccctgggagaga[A/G]gctccagtgataaggtcagccact
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.86 | 1.76 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, multiple sclerosis severity scale (continuous), multiple sclerosis severity scale (extreme), multiple sclerosis severity scale (median), resistance to kuru in aged women despite likely exposure, total cholesterol, triglycerides
PheWAS abnormality of red blood cells, anal and rectal conditions, aneurysm of artery of lower extremity, cachexia, cerebral edema and compression of brain, cholangitis, chronic periodontitis, chronic sinusitis, chronic tonsillitis and adenoiditis, coagulation defects, contact dermatitis and other eczema due to plants [except food], decreased white blood cell count, early complications of trauma or procedure, elevated white blood cell count, exostosis of jaw, extrinsic allergic alveolitis, fracture of lower limb, fracture of neck of femur, gram negative septicemia, hypersomnia, infestation, injuries to the nervous system, intracranial hemorrhage, light-headedness and vertigo, loss of teeth or edentulism, lymphadenitis, mammographic microcalcification, mastodynia, myalgia and myositis nos, myeloproliferative disease, myoclonus, nonsenile cataract, osteomyelitis, other biliary tract disease, other disorders of the nervous system, other nonmalignant breast conditions, other specified disorders of liver, paralytic strabismus, periodontitis (acute or chronic), pernicious anemia, peyronies disease, respiratory insufficiency, sacroiliitis nec, secondary malignant neoplasm, septicemia, simple goiter, spermatocele, substance addiction and disorders, symptomatic artificial menopause, throat pain, vascular insufficiency of intestine, vertiginous syndromes and other disorders of vestibular system, viral hepatitis, voice disturbance
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Whole_Blood