rs12646209 chr4:87848853 G>C
- Sequence
tttgtttcctctctctaagcttca[G/C]tgttcatggatatttcttcaaaac
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CTCF_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.40 | 1.08 | 1.22 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.98 | 1.61 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2