rs12646702 chr4:145481775 G>A
- Sequence
gggtgagcgtgtgagcgggcgggc[G/A]ggcaggcgagtgcgccgggtattg
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX1_HUMAN KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -1.94 | 2.89 | 2.00 | n/a | No Hit | |||
| KMT2A_HUMAN | -0.11 | 1.12 | 1.00 | -1.44 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
