rs12648347 chr4:54213884 A>G
- Sequence
tgaagggacccttggaactgtgac[A/G]tcaacaactgagataatacaggac
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | n/a | 3.40 | 1.50 | 4.94 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, obesity with early age of onset (age >2), triglycerides