rs12649261 chr4:152090878 T>C
- Sequence
gttttgcctctgcccccatgcagg[T/C]aggaaatggctctagaatagcact
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN SMCA4_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | n/a | 3.38 | 1.50 | 5.07 | Concordant | |||
| SMCA4_HUMAN | -0.90 | 1.52 | 1.50 | n/a | n/a | |||
| FLI1_HUMAN | -5.04 | 3.06 | 1.50 | 4.86 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Brain_Spinal_cord_cervical_c-1, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood