rs12650279 chr4:7320567 G>A
- Sequence
tgtgacagctgatgtctgccagac[G/A]gctgcaggtgggggtttagaaaca
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma) TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -1.83 | 2.96 | 2.00 | 4.26 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
