rs12650966 chr4:152644489 A>G
- Sequence
gtcatgttagctttgttcttctgt[A/G]acaacttttaatttcaacaacagc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.47 | 0.93 | 1.12 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -1.90 | 2.07 | 1.00 |
Items per page:
1 – 2 of 2