rs12653002 chr5:160265690 C>G
- Sequence
ggccaacatggtgaaaccctgtct[C/G]tactaaaatacaaaaatcagctgg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- PBX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | -3.99 | 2.67 | 1.33 | 0.51 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
