rs12654034 chr5:135489795 G>T
- Sequence
tggagcgctgcacaaaatcgtcta[G/T]cgcggagcagggcggggacgggga
- ASB in cell types
- A673 (Ewing sarcoma)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.38 | -0.07 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, ldl cholesterol change with statins, maternal transmission distortion, total cholesterol change with statins, transmission distortion, variant creutzfeldt-jakob disease