rs12655262 chr5:168291507 T>C
- Sequence
gtgaggggcggtctctccttcccc[T/C]ggcaggggcagcgtaagggtggcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) IMR-5 (Neuroblastoma) T47D (invasive ductal carcinoma) Kelly (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN CTCFL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.08 | 1.53 | 1.77 | 2.57 | Concordant | |||
| CTCFL_HUMAN | 0.03 | 1.10 | 1.29 | 4.58 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
