rs12658784 chr5:145834975 G>A
- Sequence
ctttcagctggggcaggtgtgaac[G/A]tgatgccaagcacggccccttttc
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HKC8 (kidney proximal tubule cell line) | 1.29 | n/a | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic