rs12658787 chr5:174793781 G>C
- Sequence
aaccctccgcagtcccctacccca[G/C]aaaggtttcccttccctccccttc
- ASB in cell types
- RWPE1 (prostate epithelial cells) esophagus muscularis mucosa
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | n/a | 1.95 | 2.00 | |||
| esophagus muscularis mucosa | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 2 of 2