rs12658881 chr5:60263318 C>T
- Sequence
atgatttgatttattctttctgca[C/T]ctctttttctttgttccttaacac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) iPS-derived chondrocytes
- ASB for transcription factors
- KAISO_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KAISO_HUMAN | 2.69 | -2.43 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.85 | -1.21 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hypertension (early onset hypertension), ldl cholesterol, obesity with early age of onset (age >2), paternal transmission distortion, triglycerides