rs12658884 chr5:82765720 T>C
- Sequence
aaggaaggaaaggagagagagttc[T/C]gtaaattgctgagaacttgtaaca
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.01 | -1.06 | 2.00 | -0.34 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, asthma, hypertension (early onset hypertension), neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, rheumatoid arthritis