rs12659517 chr5:39034843 G>A
- Sequence
agctcgaactgggtggagcccacc[G/A]cagctcaaggaggcctgcctgcct
- ASB in cell types
- HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT1080 (fibrosarcoma) | 2.46 | -2.49 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid